Ok buckle your seat belt because genetic testing can be a complicated subject, it's difficult to understand. So lets get started.
Proteins are the workhorse of the cell. Your body uses proteins for practically everything. Of course muscles are made of protein but there is much more. Hormones are proteins, enzymes are proteins. Molecular machines that make energy or transport materials through the cell are made of protein. No one knows for sure but there are an estimated 10,000 different types of proteins in the human body. How does your body make proteins?
Every cell in your body makes proteins from combining amino acids together in a long string and then folding the long string of amino acids into a complicated very specific molecule. These molecules often fit together with another protein or molecule like a lock and key to perform a specific function. So where does your body get amino acids from? You get amino acids from the protein you eat. If your digestion works right, you breakdown protein in your digestive system from hydrochloric acid in your stomach and other digestive enzymes. In some cases, amino acids are manufactured by your body in your liver. The gut bacteria can also manufacture amino acids that your body uses such as tyrosine, phenylalanine and tryptophan.
The average protein is 150 amino acids long. They can be 10,000 amino acids long! How does your body know what sequence to put the amino acids in so the protein works correctly? This is where DNA comes in. Each cell contains DNA. We all remember (hopefully) that DNA transmit traits to the next generation, but DNA has another very important function. DNA contains the code for the assembly of the 10,000 types of protein your body makes. When you hear of the genetic "code," that is what is meant by that, the code that your cell uses to manufacture proteins. A gene is a section of DNA that has the code for a specific protein. So lets see how that happens.
If you remember high school biology class, DNA is composed of bases that pair with a base on the other side of the DNA strand. The base are:
Cytosine (C) which pairs with Guanine (G)
Guanine (G) which pairs with Cytosine (C)
Uracil (U) which pairs with Adenine (A)
Adenine (A) which pairs with Uracil (U)
So a section of DNA may have the following base pairs. The top strand of DNA pairs with the bottom strand.
AUGUUUAACGUACCAUCGUA
UACAAAUUGCAUGGUAGCAU
Does one base correspond to one amino acid in the DNA code? For instance, If we have an A (adenine) in our DNA, will your cell put a specific amino acid in the sequence when making the protein? The answer is no. It takes three base pairs to code for one amino acid. This design of DNA allows your body to code for the 20 amino acids your body uses with only four bases. For example, in the above code the top DNA's first bases are AUG. This would code for methionine. So what happens when you have a mutation?
In the above example, let's suppose you have a C instead of a G. This would change the code and the amino acid threonine would be inserted in the chain of amino acids instead of methionine. This can change how efficiently the enzyme would work. These one letter changes in the bases of DNA are called single nucleotide polymorphisms or SNP's. (pronounced snips) SNP's are not necessarily bad. SNP's are what make people different from each other. However certain SNP's are known to cause problems with different metabolic pathways in the body. Some are listed below.
It is important to know some things we are learning about SNP's.
1. DNA is not destiny. Other factors enter into health besides DNA. Epigenetics considers some of the other factors like diet, environment and lifestyle.
2. SNP science is a new science that is constantly changing. New information is discovered almost everyday. With chronic health problems genetic analysis can be very useful however it is not the be all and end all. It can be an important piece of the puzzle.
MTHFR
An example of a common SNP is the MTHFR gene. MTHFR stands for (no jokes please) methyltetrahydrofolate reductase. This from genetics home reference:
The MTHFR gene provides instructions for making an enzyme called methylenetetrahydrofolate reductase. This enzyme plays a role in processing amino acids, the building blocks of proteins. Methylenetetrahydrofolate reductase is important for a chemical reaction involving forms of the vitamin folate (also called vitamin B9). Specifically, this enzyme converts a molecule called 5,10-methylenetetrahydrofolate to a molecule called 5-methyltetrahydrofolate. This reaction is required for the multistep process that converts the amino acid homocysteine to another amino acid, methionine. The body uses methionine to make proteins and other important compounds.
In English, this means people with a MTHFR SNP may have problems with detoxifying chemicals in their food and environment. They may also have problems with inflammation due to the decreased ability to convert homocysteine to methionine.
COMT
Catechol-O-Methyltransferase (COMT) is an enzyme that breaks down catecholamine in the brain. Catecholamine regulates aggressive behavior in the brain. It controls how you react to stress because it controls the breakdown of stress hormones. It is now known that 80% of people have a SNP in the COMT V158M gene.
FUT2
Fucosyltransferase 2 is an enzyme that has been implicated in Crohn's disease. If you have a FUT2 mutation you will have increase in inflammation and infections. The gene makes fucose (not fructose). Fucose feeds the good bacteria in the gut and that helps to starve out the bad bacteria. A SNP in this gene can cause gut issues.
There are hundreds of SNP's identified with fall into the following categories:
To be tested for SNP's requires a swab of your mouth. You will send the test to Ancestry,com or 23 and me. When the results come back you will be instructed how to get the data from them. We then will analyze this data using special constantly updated software with the latest information. A report will then be printed and reviewed with you.